Submandibular Gland Acinar Cells Express Multiple 1-Adrenoceptor Subtypes

We evaluated an acinar cell line (SMG-C10) cloned from rat submandibular glands as a possible model for 1-adrenoceptor regulation of submandibular function. 1-Adrenoceptors are subdivided into three subtypes called 1A, 1B, and 1D, which can be distinguished from one another by their differential affinity values for subtype-selective 1-adrenoceptor antagonists. Thus, 1-adrenoceptor subtypes in SMG-C10 cells were characterized with reverse transcription-polymerase chain reaction (RT-PCR) and [H]prazosin binding in side-by-side experiments with native submandibular glands. RT-PCR identified mRNAs for 1A-, 1B-, and 1D-adrenoceptors in SMG-C10 cells and submandibular glands. The inhibition of [H]prazosin binding by 5-methylurapidil ( 1Aselective) was biphasic and fit best to a two-site binding model with 40 8% high (KiH)and 60 10% low (KiL)-affinity binding sites in SMG-C10 cells, and 76% highand 24% low-affinity binding sites in submandibular glands. Respective KiH and KiL values for 5-methylurapidil were 1.9 0.4 and 100 30 nM in SMG-C10 cells and 3.2 0.8 and 170 20 nM in submandibular glands. BMY-7378 [8-[2-[4-(2-methoxyphenyl)1-piperazinyl]ethyl]-8-azaspiro[4.5]decane-7,9-dione dihydrochloride ( 1D-selective)] bound with low affinity in SMG-C10 cells and submandibular glands with Ki values of 81 20 and 110 20 nM, respectively. Chloroethylclondine, an irreversible alkylating agent selective for 1B adrenoceptors, reduced the density of [H]prazosin binding sites by 42 and 26% in SMGC10 and submandibular membranes, respectively. Thus, SMG-C10 cells and submandibular glands are similar in expressing receptor protein for 1Aand 1B-adrenoceptor subtypes, establishing SMG-C10 cells as a potential model for 1-adrenoceptor-mediated secretion. The submandibular gland is 1 of 3 major salivary glands in mammals. The secretory end pieces of the submandibular gland are composed of acinar cells, which secrete fluid and protein that protect the oral mucosa and teeth, lubricate the throat for easy swallowing, and inhibit microbial overgrowth of the oral cavity. The submandibular gland is innervated by autonomic nerves, which provide the principal control over salivary secretion (Baum, 1987). Physiological stimulation of autonomic sympathetic nerves results in the release of norepinephrine, which activates 1-adrenoceptors on submandibular acinar cells, causing secretion of fluid, electrolytes, amylase, and mucins (Quissell, 1980; Quissell and Barzen, 1980). An important impediment to a better understanding of 1adrenoceptor regulation of secretion in submandibular glands has been the lack of an immortalized cell line maintaining the phenotypical characteristics of an epithelial cell of acinar origin. Because acinar cells generate the secretory product, a cell line that is similar in phenotype to native submandibular acinar cells would be a useful model for studying the role of 1-adrenoceptors and their signaling pathways in submandibular glands. Quissell et al. (1997) reported the immortalization of two clonal rat submandibular gland acinar cell lines established from the same preparation (SMG-C6 and SMG-C10). They, as well as others (Liu et al., 2000), have shown that both cell lines exhibit similar morphological, biochemical, and functional characteristics as those in native submandibular acinar cells. For example, SMG-C6 cells and SMG-C10 cells are polarized in culture and, like native acinar cells, express functional adrenergic, muscarinic, and purinergic receptors that couple to an elevation in intracellular free calcium. The similarities between native submandibular acinar cells and SMG-C6/C10 cells with respect to polarity, signal transduction pathways, and other morphological characteristics suggest that these imThis study was supported by National Institute of Dental and Craniofacial Research Grant RO3-DE12530 to Dr. Charles S. Bockman. Article, publication date, and citation information can be found at http://jpet.aspetjournals.org. doi:10.1124/jpet.104.066399. ABBREVIATIONS: RT-PCR, reverse transcription-polymerase chain reaction; BMY-7378, 8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8azaspiro[4.5]decane-7,9-dione dihydrochloride; WB-4101, 2-([2,6-dimethoxyphenoxyethyl])aminomethyl)-1,4-benzodioxane; S, sense; AS, antisense; bp, base pair(s). 0022-3565/04/3111-364–372$20.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 311, No. 1 Copyright © 2004 by The American Society for Pharmacology and Experimental Therapeutics 66399/1177235 JPET 311:364–372, 2004 Printed in U.S.A. 364 at A PE T Jornals on Sptem er 2, 2017 jpet.asjournals.org D ow nladed from mortalized acinar cell lines are useful tools for studying salivary gland secretion. However, the 1-adrenoceptor subtypes expressed in SMG-C6/C10 cells are unknown. 1-Adrenoceptors do not represent a homogenous population of receptors. Molecular cloning and pharmacological studies performed using native tissues are in agreement with one another and show that there are separate genes encoding for three structurally and pharmacologically distinct cellsurface receptor proteins. These 1-adrenoceptor subtypes are referred to as the 1A-, 1B-, and 1D-adrenoceptor subtypes (Hieble et al., 1995). The 1-adrenoceptor subtypes can be distinguished from one another using reverse transcription-polymerase chain reaction (RT-PCR) with gene-specific primers and radioligand binding to determine affinity constants for 1-adrenoceptor subtype-selective drugs. The possibility that immortalization, culture conditions, or both alter expression patterns and/or the pharmacological characteristics of 1-adrenoceptor subtypes in SMG-C6/C10 cells should be considered if these cell lines are to be used as a model in secretion studies. Thus, the overall aim of this study was to characterize the 1-adrenoceptor subtypes in side-by-side experiments comparing SMG-C10 cells with native rat submandibular glands. We used RT-PCR to identify the mRNA for the 1-adrenoceptor subtypes present in SMG-C10 cells and submandibular glands. In addition, we characterized the 1-adrenoceptor subtypes expressed in SMG-C10 cells and submandibular glands by determining the affinities of several 1-adrenoceptor subtype-selective drugs for inhibiting specific [H]prazosin binding. Materials and Methods Drugs. BMY-7378 dihydrochloride, chloroethylclonidine dihydrochloride, 5-methylurapidil, phentolamine methanesulfonate, prazosin hydrochloride, and WB-4101 hydrochloride were obtained from Sigma-Aldrich (St. Louis, MO), and [7-methoxy-H]prazosin ([H]prazosin) (70–87 Ci/mmol) was obtained from PerkinElmer Life and Analytical Sciences (Boston, MA). Cell Culture. In preliminary experiments, the density of specific [H]prazosin binding sites was higher in SMG-C10 cells compared with SMG-C6 cells; thus, we used SMG-C10 cells in the present study. SMG-C10 cells (generously provided by Dr. David O. Quissell, School of Dentistry, University of Colorado Health Sciences Center, Denver, CO) were seeded onto T-75 (8 10 cells) Falcon Primaria tissue culture flasks (BD Biosciences, Franklin Lakes, NJ) and grown in Dulbecco’s modified Eagle’s medium/F-12 nutrient mixture (1:1) and 2.5% fetal bovine serum (Invitrogen, Carlsbad, CA). Growth medium was supplemented with 2 mM glutamine and 4 g/ml transferrin (Invitrogen); 0.1 M retinoic acid, 2 nM triiodothyronine, 1 M hydrocortisone, 5 g/ml insulin, and 50 g/ml gentamicin (SigmaAldrich); 50 ng/ml epidermal growth factor (BD Biosciences); and trace element mix (Biofluids, Rockville, MD). Cells were grown to confluence at 37°C in a humidified 95% air/5% CO2 incubator and used for experiments between passages 18 and 22. Total RNA Isolation. Total cellular RNA was prepared from 100 mg of pulverized frozen rat submandibular glands and confluent SMG-C10 cultures grown in T-75 tissue culture flasks using TRIzol (Invitrogen) according to the manufacturer’s instructions. Contaminating genomic DNA was removed from total RNA by treatment with RNase-free DNase I, followed by RNA extraction with water-saturated phenol-chloroform and precipitation with ethanol. The integrity of the RNA was confirmed by denaturing agarose gel electrophoresis. Total RNA was determined by measuring the absorbance at 260 nm with a Beckman DU-650 spectrophotometer (Beckman Coulter, Fullerton, CA). Preparations were stored at 70°C. RT-PCR. Approximately 1 g of total RNA from either rat submandibular glands or SMG-C10 cells was reverse-transcribed using 25 pmol of random hexamers and 25 pmol of oligo d(T) primers. First-strand cDNA was synthesized from RNA preparations using 50 units of murine leukemia virus reverse transcriptase (PerkinElmer Life and Analytical Sciences) in a 10l reaction volume containing 20 units of RNasin (Promega, Madison, WI), 1 mM deoxynucleoside-5 -triphosphate, and 2.5 mM MgCl2 in PCR buffer (Invitrogen). The reaction was incubated at room temperature for 15 min and then at 42°C for 50 min, and followed by enzyme inactivation for 5 min at 95°C in a RoboCycler Gradient 96 Thermal Cycler (Stratagene, LaJolla, CA). PCR was performed on 10 l of the reverse-transcribed cDNA reaction using 1adrenoceptor subtype-specific oligonucleotide primers synthesized on an Applied Biosystems Synthesizer (PerkinElmer Life and Analytical Sciences). The sense (S) and antisense (AS) primer sequences were GTAGCCAAGAGAGAAAGCCG ( 1A-S), CAACCCACCACGATGCCCAG ( 1A-AS); GCTCCTTCTACATCCCGCTCG ( 1B-S), AGGGGAGCCAACATAAGATGA ( 1B-AS); and CGTGTGCTCCTTCTACCTACC ( 1D-S), GCACAGGACGAAGACACCCAC ( 1D-AS). The design of 1-adrenoceptor subtype-specific primer pairs was previously described (Scofield et al., 1995). The PCR mixture contained 1.25 units of TaqDNA polymerase (Invitrogen), 3 mM MgCl2, 25 pmol of AS primer, 25 pmol of S primer, and 0.2 mM deoxynucleoside-5 -triphosphate in PCR buffer. The cDNA template and primers were denatured for 5 min at 95°C, then amplified in a 50l reaction volume for 40 cycles of denaturation at 95°C for 45 s, followed by annealing for 45 s at 55°C, and then extension at 72°C for 45 s. After amplification, products were extended further by incubation at 72°C for 7 min. The products were horizontally electrophoresed on a 2% agarose-ethidium bromide gel. The 212-, 300-, and 304-bp PCR products for the 1A-, 1B-, and 1D-adrenoceptor subtypes, respectively, were cloned using a TA Cloning Kit with a PCR II vector (Invitrogen) and sequenced to confirm the primer specificity. The absence of genomic DNA for each reaction was confirmed by amplification of the RNA that was not previously incubated with reverse transcriptase. Membrane Preparation. SMG-C10 cells were washed twice with phosphate-buffered saline and removed from T-75 tissue culture flasks with a rubber policeman. Cells were homogenized twice in 10 volumes of ice-cold 50 mM Tris buffer (pH 7.4) using a Janke and Kunkel Ultra-Turrax T25 homogenizer (Janke and Kunkel, Staufen, Germany) at 22,000 rpm for 10 s. The homogenate was centrifuged at 30,000g for 15 min, and the supernatant was discarded. The membrane pellet was resuspended in Tris buffer, washed twice more by centrifugation, and stored at 78°C. Male Sprague-Dawley rats (140–190 g) were anesthetized with pentobarbital (50 mg/kg i.p.) and exsanguinated by cutting the abdominal aorta as approved by Creighton University’s Institutional Animal Care and Use Committee. Submandibular glands were removed and placed in ice-cold Krebs’ solution at pH 7.4 containing 118 mM NaCl, 4.7 mM KCl, 1.3 mM CaCl2, 1.2 mM MgSO4, 25 mM NaHCO3, 1.2 mM KH2PO4, and 11.7 mM dextrose; trimmed of visible fat, fascia, lymph nodes, blood vessels, and ducts; and then minced with iris scissors. The mince was centrifuged at 1,000g for 5 min at 4°C, and the supernatant was discarded. The resulting mince was enriched with acinar units. The pellet was resuspended in 20 volumes of Tris buffer, and membranes were prepared as described for SMG-C10 cells, with the exception of an additional step whereby the homogenate was filtered through a 100m nylon mesh. Radioligand Binding Assays. Membrane pellets were resuspended and homogenized in Tris buffer. Assay tubes used in radioligand binding experiments were pretreated with Sigmacote (SigmaAldrich) according to the manufacturer’s instructions. For saturation binding experiments, total [H]prazosin binding was determined using duplicate tubes containing 300 l of membrane suspension (150 g and 100 g/0.5 ml of assay volume for SMG-C10 cells and submandibular glands, respectively), 100 l of Tris buffer, and 100 l of [H]prazosin ranging in concentration from 0.02 to 2.5 nM. To a parallel set of duplicate tubes, 100 l of 10 M phentolamine in 1-Adrenoceptor Subtypes in Submandibular Acinar Cells 365 at A PE T Jornals on Sptem er 2, 2017 jpet.asjournals.org D ow nladed from Tris buffer was added to determine nonspecific binding. After a 30-min incubation in a shaking water bath at 37°C, a 48-sample cell harvester (Brandel Inc., Gaithersburg, MD) was used to filter membrane suspensions through GF/B glass fiber filter strips (Whatman, Maidstone, UK) pretreated with polyethylenimine (0.2% w/v for 30 min) and bovine serum albumin (0.1% w/v for 15 min). Tubes and filters were washed three times with 5 ml of ice-cold Tris buffer, and radioactivity retained on the filters was counted by liquid scintillation spectroscopy. Specific binding was calculated as the difference between total and nonspecific binding. For competition binding experiments, duplicate tubes containing 300 l of membrane suspension, 100 l of 0.3 nM [H]prazosin, and 100 l of increasing concentrations of various unlabeled drugs were incubated and processed as described for saturation experiments. The protein concentration was determined by the method of Lowry et al. (1951) using bovine serum albumin as the standard. Chloroethylclonidine Treatment. Crude membranes were treated with chloroethylclonidine as previously described (Minneman et al., 1988). Briefly, membrane pellets were resuspended in 5 ml of 50 mM Tris buffer and incubated with or without 30 M chloroethylclonidine for 12 min at 37°C. Chloroethylclonidine treatment was terminated by a 4-fold dilution with ice-cold Tris buffer and then followed with three successive washings by centrifugation (30,000g for 15 min) to remove any unbound drug. Treated and nontreated membranes were then used in side-by-side radioligand binding experiments. Data Analysis. Radioligand binding data were analyzed using a nonlinear least-squares curve-fitting program (GraphPad Prism; GraphPad Software, San Diego, CA) to determine Kd and Bmax values from saturation binding experiments and IC50 values from competition binding experiments. Ki values were calculated from IC50 values by using the method of Cheng and Prusoff (1973). All values are given as means S.E. The F test was used to determine whether or not the binding data fit best to a 1or 2-site binding model. A value of P 0.05 was used to conclude that the two-site model fit the data